WormBase Tree Display for Variation: WBVar00251564

WBVar00251564 Name: Public_name: tm2720
    Other_name: B0024.9a.1:c.264_*43del
    HGVSg: CHROMOSOME_V:g.10315036_10315253del
  Sequence_details: SMap: S_parent: Sequence: B0024
    Flanking_sequences: atcctttcaggtaaacggaagacaaggaag tttaatggttcatttaaattagaggaataa
    Mapping_target: B0024
    Source_location: 7 CHROMOSOME_V 10315035 10315254 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2720_external
      tm2720_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00040311
      WBStrain00040314
      WBStrain00040316
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2720
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007100
      WBGene00007099
    Transcript: B0024.9b.1 VEP_consequence: coding_sequence_variant,3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 186-?
        CDS_position: 186-?
        Protein_position: 62-?
        Exon_number: 3/3
      B0024.10.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 1832-?
        Exon_number: 6/6
      B0024.9a.1 VEP_consequence: stop_lost,3_prime_UTR_variant
        VEP_impact: HIGH
        HGVSc: B0024.9a.1:c.264_*43del
        cDNA_position: 264-481
        CDS_position: 264-?
        Protein_position: 88-?
        Exon_number: 3-4/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000124 Paper_evidence: WBPaper00040582
        Curator_confirmed: WBPerson2987
        Remark: "The conceptual translation of the tm2720 mRNA variant produces a truncated protein (ΔTRX-2) that lacks the C-terminal half of the mature wild-type TRX-2 protein, which contains amino acid residues critical for protein-protein interaction and redox active-site stabilization (11). Consistent with this analysis, recombinant ΔTRX-2 is devoid of enzymatic activity in both the 1,4-dithio-D-threitol (DTT) and reduced nicotinamide adenine dinucleotide phosphate (NADPH)/thioredoxin reductase assay as compared with that of mature full-length TRX-2 (Fig. 1E, F), thus supporting the notion that the tm2720 allele is a loss-of-function allele." Paper_evidence: WBPaper00040582
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000295 Paper_evidence: WBPaper00040582
        Curator_confirmed: WBPerson2987
        Remark: "No significant differences in sensitivity were found with arsenite, juglone, sodium azide, paraquat or thermal stress treatments (Fig. 5A-E), although the trx-2 (tm2720) mutant was slightly more resistant to thermal stress and trx-2 (tm2720) single and trx-2 (tm2720); trxr-2(tm2047) double mutant showed a slightly higher resistance to paraquat treatment." Paper_evidence: WBPaper00040582
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: Animals were grown at 37 degrees Celsius and assayed for survival over time Paper_evidence: WBPaper00040582
              Curator_confirmed: WBPerson2987
          Temperature: 37 Paper_evidence: WBPaper00040582
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000461 Paper_evidence: WBPaper00040582
        Curator_confirmed: WBPerson2987
        Remark: "No significant differences in sensitivity were found with arsenite, juglone, sodium azide, paraquat or thermal stress treatments (Fig. 5A-E), although the trx-2 (tm2720) mutant was slightly more resistant to thermal stress and trx-2 (tm2720) single and trx-2 (tm2720); trxr-2(tm2047) double mutant showed a slightly higher resistance to paraquat treatment." Paper_evidence: WBPaper00040582
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00002747 Paper_evidence: WBPaper00040582
              Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: Animals were exposed to 4 mM paraquat and assayed for survival over time Paper_evidence: WBPaper00040582
              Curator_confirmed: WBPerson2987
    Phenotype_not_observed (11)
  Reference: WBPaper00040582
  Remark (2)
  Method: NBP_knockout_allele