WormBase Tree Display for Variation: WBVar00251619

WBVar00251619 Name: Public_name: tm2786
    Other_name: C27H6.2.1:c.941_1332+19delinsAA
    HGVSg: CHROMOSOME_V:g.9979165_9979575delinsTT
  Sequence_details: SMap: S_parent: Sequence: C27H6
    Flanking_sequences: ctgaatagcgatttatttaatacatgaact ttagttcagccactccactttcaatgtatt
    Mapping_target: C27H6
    Source_location: 7 CHROMOSOME_V 9979164 9979576 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TT
      Deletion
    PCR_product: tm2786_external
      tm2786_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2786
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007784
    Transcript: C27H6.2.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C27H6.2.1:c.941_1332+19delinsAA
        cDNA_position: 1047-?
        CDS_position: 941-?
        Protein_position: 314-?
        Intron_number: 5/6
        Exon_number: 5/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment from Dr. S. Mango to the NBP: L3 arrest (lethal). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000083 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment from Dr. S. Mango to the NBP: L3 arrest (lethal). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 16827/16828-TT-17238/17239 (411 bp deletion + 2 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele