WormBase Tree Display for Variation: WBVar00251625
expand all nodes | collapse all nodes | view schema
WBVar00251625 | Name | Public_name | tm2793 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | B0432.4.1:c.59+19_204del | |||||||
HGVSg | CHROMOSOME_II:g.286710_286912del | |||||||
Sequence_details | SMap | S_parent | Sequence | B0432 | ||||
Flanking_sequences | aggaaccgctgggtgggttttcggaatatt | aatggactttctgccggacttttgcgtcaa | ||||||
Mapping_target | B0432 | |||||||
Source_location | 7 | CHROMOSOME_II | 286709 | 286913 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2793_external | |||||||
tm2793_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2793 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00015186 | ||||||
Transcript | B0432.4.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | B0432.4.1:c.59+19_204del | |||||||
cDNA_position | ?-212 | |||||||
CDS_position | ?-204 | |||||||
Protein_position | ?-68 | |||||||
Intron_number | 2/6 | |||||||
Exon_number | 3/7 | |||||||
Interactor | WBInteraction000501093 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype | WBPhenotype:0000241 | Paper_evidence | WBPaper00038273 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | A two-fold increase was observed in the number of apoptotic corpses per gonad arm. | Paper_evidence | WBPaper00038273 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000463 | Paper_evidence | WBPaper00038273 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | A 6% reduction was observed in glucose concentration in misc-1 mutants compared to control animals. | Paper_evidence | WBPaper00038273 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000823 | Paper_evidence | WBPaper00038273 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Absence of MISC-1 greatly increases the number of pH3-positive (histone 3 phosphorylation) mitotic germline stem cells and causes an extended mitotic zone (data not shown). | Paper_evidence | WBPaper00038273 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001401 | Paper_evidence | WBPaper00038273 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | When analyzed by transmission electron microscopy, morphological defects in the mitochondria are observed. The mitochondria of misc-1 worms are smaller and more spherical. High magnification images indicate that compared to N2 controls, the mitochondrial cristae of the misc-1 mutant are more disorganized, possess increased blebbing characteristics and adopt more irregular orientations. Furthermore, the cristae of misc-1 animals are fewer in number. | Paper_evidence | WBPaper00038273 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000033 | Paper_evidence | WBPaper00038273 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Homozygous animals have the same development time as wild type (measured as time from egg laying to day one of adulthood). | Paper_evidence | WBPaper00038273 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000039 | Paper_evidence | WBPaper00038273 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Homozygous animals have normal life span (data not shown). | Paper_evidence | WBPaper00038273 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00038273 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Homozygous animals are morphologically normal. | Paper_evidence | WBPaper00038273 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001901 | Paper_evidence | WBPaper00038273 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Homozygous animals have normal fat staining. | Paper_evidence | WBPaper00038273 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038273 | |||||||
Remark | 29349/29350-29552/29553 (203 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |