WormBase Tree Display for Variation: WBVar00251628

WBVar00251628 Name: Public_name: tm2797
    HGVSg: CHROMOSOME_IV:g.6155116_6155590delinsTGGAAT
  Sequence_details: SMap: S_parent: Sequence: C11D2
    Flanking_sequences: gtgaagtgttctcaaagttggaatgtaatc ggaatgaaaacagaagatgatacgaaaagc
    Mapping_target: C11D2
    Source_location: 7 CHROMOSOME_IV 6155115 6155591 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TGGAAT
      Deletion
    PCR_product: tm2797_external
      tm2797_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2797
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015702
      WBGene00015703
    Transcript: C11D2.4.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 1190-?
        Exon_number: 6/6
      C11D2.7.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-235
        CDS_position: ?-231
        Protein_position: ?-77
        Intron_number: 2/4
        Exon_number: 1-3/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
  Remark: 7266/7267-TGGAAT-7741/7742 (475 bp deletion + 6 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele