WormBase Tree Display for Variation: WBVar00251635

WBVar00251635 Name: Public_name: tm2806
    Other_name: C14A4.11.1:c.75-28_351delinsCA
    HGVSg: CHROMOSOME_II:g.10606722_10607163delinsTG
  Sequence_details: SMap: S_parent: Sequence: C14A4
    Flanking_sequences: gaaggcgtgacgatccgacatttcttcggg ttaaaaactgatatttcttgaaacccactt
    Mapping_target: C14A4
    Source_location: 7 CHROMOSOME_II 10606721 10607164 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TG
      Deletion
    PCR_product: tm2806_external
      tm2806_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2806
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007561
    Transcript: C14A4.11.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C14A4.11.1:c.75-28_351delinsCA
        cDNA_position: ?-361
        CDS_position: ?-351
        Protein_position: ?-117
        Intron_number: 2-4/6
        Exon_number: 3-5/7
    Interactor: WBInteraction000525176
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comments to the National Bioresource Project of Japan: Dr.J.M. Schumacher: Ste. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
  Disease_info: Models_disease: DOID:0060669
    Models_disease_in_annotation: WBDOannot00000809
  Remark: 26865/26866-TG-27307/27308 (442 bp deletion + 2 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele