WormBase Tree Display for Variation: WBVar00251653

WBVar00251653 Name: Public_name: tm2827
    Other_name: Y53C10A.4.1:c.1196_1448-9del
    HGVSg: CHROMOSOME_I:g.11982778_11983277del
  Sequence_details: SMap: S_parent: Sequence: Y53C10A
    Flanking_sequences: ccaaaatgaatgcttcatccttatcagtat tattccagacgccgacgacgcaacctccca
    Mapping_target: Y53C10A
    Source_location: 7 CHROMOSOME_I 11982777 11983278 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2827_external
      tm2827_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2827
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00013135
    Transcript: Y53C10A.4.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y53C10A.4.1:c.1196_1448-9del
        cDNA_position: 1302-?
        CDS_position: 1196-?
        Protein_position: 399-?
        Intron_number: 8/13
        Exon_number: 8/14
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
  Remark: 30456/30457-30956/30957 (500 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele