WormBase Tree Display for Variation: WBVar00251654
expand all nodes | collapse all nodes | view schema
WBVar00251654 | Name | Public_name | tm2828 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T26A5.5b.1:c.983_1232del | |||||||
CE50209:p.Gln330IlefsTer2 | ||||||||
T26A5.5a.1:c.983_1232del | ||||||||
CE50262:p.Gln330IlefsTer2 | ||||||||
HGVSg | CHROMOSOME_III:g.6455563_6455860del | |||||||
Sequence_details | SMap | S_parent | Sequence | T26A5 | ||||
Flanking_sequences | gaggcaattttcttcactcacaatcatgca | aaacgatatgattaaaggagacgaggaatc | ||||||
Mapping_target | T26A5 | |||||||
Source_location | 7 | CHROMOSOME_III | 6455562 | 6455861 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2828_external | |||||||
tm2828_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2828 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00020821 | ||||||
Transcript | T26A5.5b.1 (11) | |||||||
T26A5.5a.1 (11) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000030 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. M. Han: wild-type growth. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. M. Han: fertile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000699 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. M. Han: normal vulval development. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 7719/7720-8017/8018 (298 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |