WormBase Tree Display for Variation: WBVar00251656

WBVar00251656 Name: Public_name: tm2830
    HGVSg: CHROMOSOME_IV:g.8290212_8290614delinsATAATATCTCTATTTTTTATAAT
  Sequence_details: SMap: S_parent: Sequence: K07H8
    Flanking_sequences: tgcaaatcctccattaatctctattttttt gagccatggtcgaaacctacaacgctaaat
    Mapping_target: K07H8
    Source_location: 7 CHROMOSOME_IV 8290211 8290615 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: ATAATATCTCTATTTTTTATAAT
      Deletion
    PCR_product: tm2830_external
      tm2830_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2830
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000923
    Transcript: K07H8.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-290
        CDS_position: ?-286
        Protein_position: ?-96
        Intron_number: 2/4
        Exon_number: 1-3/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
  Remark: 30837/30838-ATAATATCTCTATTTTTTATAAT-31240/31241 (403 bp deletion + 23 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele