WormBase Tree Display for Variation: WBVar00251686

WBVar00251686 Name: Public_name: tm2865
    Other_name: CE03820:p.Asn43AlafsTer11
      ZK507.6.1:c.123_534del
    HGVSg: CHROMOSOME_III:g.9108309_9108814del
  Sequence_details: SMap: S_parent: Sequence: ZK507
    Flanking_sequences: ttcttcttttccaaattcctttttgcgctg gttccaatttgacgtgtcaattttcctccc
    Mapping_target: ZK507
    Source_location: 7 CHROMOSOME_III 9108308 9108815 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2865_external
      tm2865_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2865
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000863
    Transcript: ZK507.6.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. K.F. O'Connell: normal hatching. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000072 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K.F. O'Connell: body shape. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K.F. O'Connell: locomotion Dr. E. Kipreos: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. K.F. O'Connell: normal hatching; Dr. E. Kipreos: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 9642/9643-10148/10149 (506 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele