WormBase Tree Display for Variation: WBVar00251718

WBVar00251718 Name: Public_name: tm2903
  Sequence_details: SMap: S_parent: Sequence: Y76G2A
    Flanking_sequences: ttgttacaatgaaaatcgggagaattttta aatatgttcaaacgggatcacagaagctca
    Mapping_target: Y76G2A
    Source_location: 7 CHROMOSOME_I 5978683 5979360 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: A
      Deletion
    PCR_product: tm2903_external
      tm2903_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2903
    NBP_allele
    Status: Live
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
  Remark: 3851/3852-A-4527/4528 (676 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele