WormBase Tree Display for Variation: WBVar00251726
expand all nodes | collapse all nodes | view schema
WBVar00251726 | Name | Public_name | tm2913 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | Y113G7A.5.1:c.295_515del | ||||||||
CE32005:p.Tyr99ThrfsTer44 | |||||||||
HGVSg | CHROMOSOME_V:g.20029029_20029325del | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y113G7A | |||||
Flanking_sequences | tccagaatcctgaccgagttgctcagtaaa | accgaatgtatgtatagtcaactcaaaagg | |||||||
Mapping_target | Y113G7A | ||||||||
Source_location | 7 | CHROMOSOME_V | 20029028 | 20029326 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm2913_external | ||||||||
tm2913_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 2913 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00013746 | |||||||
Transcript | Y113G7A.5.1 (11) | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | V | |||||||
Description | Phenotype | WBPhenotype:0000228 | Paper_evidence | WBPaper00033406 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "... we found that lgc-55 mutants had an increase in spontaneous reversals compared to the wild-type , although the increase was less pronounced than that of the tdc-1 mutants ( Figure 7B ) ." | Paper_evidence | WBPaper00033406 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00048522 | |||||||
WBPaper00033406 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In response to touch, wild-type animals suppressed head movements by relaxing their head (Δhead = 5 0.001 μm, n = 39) and reversed on average 3.14 0.18 backward body bends (n = 100) (Fig 6, S4 Fig, S3 Movie). lgc-55 null mutant animals made shorter reversals than the wild type and fail to suppress the exploratory head movements during the reversal, with no significant change in head length (2.45 0.15 backward body bends, n = 100)." | Paper_evidence | WBPaper00048522 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"... we found that lgc-55 mutant animals failed to suppress head oscillations in response to anterior touch ( Figure 5 ; Movie S5 ) ." | Paper_evidence | WBPaper00033406 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
" Like tdc-1 mutants , lgc-55 mutants initiated backward locomotion normally in response to anterior touch but displayed shorter runs of backward movement ( 2.4 +/- 0.1 body bends ) than the wild-type ( 3.3 +/- 0.1 body bends ) ( Figures 7A and S6 ) ." | Paper_evidence | WBPaper00033406 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00048522 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Synaptic markers also properly localized in tyramine-deficient, tdc-1 mutants and lgc-55 null mutants (Fig 3B and S3 Fig). The postsynaptic densities were expanded in tyramine-deficient animals, whereas presynaptic densities were enlarged in the tyramine receptor mutants. The RIM-AVB synaptic markers were slightly more diffuse in tyramine signaling mutants and the LGC-55 cation-II transgenic animals." | Paper_evidence | WBPaper00048522 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005835 | PATO:0000460 | Paper_evidence | WBPaper00048522 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0005841 | PATO:0000460 | Paper_evidence | WBPaper00048522 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | zfIs61 [Pcex-1::mCherry::RAB-3; LIN-15(+)] | Paper_evidence | WBPaper00048522 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001005 | Paper_evidence | WBPaper00039982 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants reverse normally in response to touch; however,mutant animals back up slightly less far than the wild-type. | Paper_evidence | WBPaper00039982 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002134 | Paper_evidence | WBPaper00039982 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lgc-55 mutants initiated reversals when wedged in a constricting ring trap of Drechslerella spp.: D. dactyloides, but escaped less frequently than wild-type animals. | Paper_evidence | WBPaper00039982 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002320 | Paper_evidence | WBPaper00033406 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that lgc-55 mutants displayed more short reversals than wild-type worms ( Figure 7C ) . The increase in short reversals was even more dramatic in the tdc-1 mutants . An lgc-55 minigene rescued the defects of lgc-55 mutants in reversal behavior in both the touch-induced and spontaneous reversal assays ." | Paper_evidence | WBPaper00033406 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002366 | Paper_evidence | WBPaper00039982 | |||||||
WBPaper00048522 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | lgc-55 mutant animals fail to suppress exploratory head movements during touch-induced reversals. | Paper_evidence | WBPaper00039982 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
"In response to touch, wild-type animals suppressed head movements by relaxing their head (Δhead = 5 0.001 μm, n = 39) and reversed on average 3.14 0.18 backward body bends (n = 100) (Fig 6, S4 Fig, S3 Movie). lgc-55 null mutant animals made shorter reversals than the wild type and fail to suppress the exploratory head movements during the reversal, with no significant change in head length (2.45 0.15 backward body bends, n = 100)." | Paper_evidence | WBPaper00048522 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002367 | Paper_evidence | WBPaper00039982 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Once mutants entered the holes in a nylon mesh, the animals took more than twice as long to extricate themselves as did wild-type animals. | Paper_evidence | WBPaper00039982 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002399 | Paper_evidence | WBPaper00048522 | |||||||
WBPaper00033406 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Exogenous tyramine induced neck muscle relaxation and lengthening of the head in wild-type (LGC-55 anion) animals and lgc-55 null mutant animals that express a rescuing LGC-55 anion transgene (wild type: Δhead = 10 6 μm, n = 68; Plgc-55:LGC-55(zfEx2): Δhead = 11 4 μm, n = 75) (Fig 5A and 5B). Head movements persisted in lgc-55 mutants [19], with no significant change in head length (lgc-55(tm2913): Δhead = 3 13 μm, n = 65)." | Paper_evidence | WBPaper00048522 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"In wild-type animals, exogenous tyramine also induced long backward runs preceding immobilization through the LGC-55 mediated inhibition of the AVB premotor interneurons that drive forward locomotion (wild type: Δfwd-bwd = -8.46 2.98 body bends, n = 40) (Fig 5A and 5D, S1 Movie) [19]. Backward locomotion was further increased in transgenic animals that expressed the LGC-55 anion under control of its endogenous promoter (Plgc-55:LGC-55 (zfEx2): Δfwd-bwd = -28.5 3.3 backward body bends, n = 29). lgc-55 null mutants did not make long reversals when exposed to exogenous tyramine (lgc-55(tm2913): Δfwd-bwd = 2.58 0.9 body bends, n = 34)." | Paper_evidence | WBPaper00048522 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"Like lgc-55 ( zf11 ) and lgc-55 ( zf53 ) mutants , lgc-55 ( tm2913 ) mutants animals are resistant to tyramine-mediated head paralysis , suggesting that lgc-55 ( zf11 ) and lgc-55 ( zf53 ) also represent loss-of-function alleles. We were able to restore tyramine sensitivity by expressing a transgenic lgc-55 minigene in lgc-55 mutants ( Figure 1 C ) . These data indicate that lgc-55 is required for the paralytic effects of exogenous tyramine on head movements." | Paper_evidence | WBPaper00033406 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00001396 | Paper_evidence | WBPaper00048522 | |||||
WBPaper00033406 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000033 | Paper_evidence | WBPaper00039982 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lgc-55 mutant animals are indistinguishable from the wild-type with respect to developmental timing. | Paper_evidence | WBPaper00039982 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000231 | Paper_evidence | WBPaper00039982 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lgc-55 mutant animals are indistinguishable from the wild-type with respect to size. | Paper_evidence | WBPaper00039982 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00039982 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lgc-55 mutant animals are indistinguishable from the wild-type with respect to locomotion rate and locomotion pattern. | Paper_evidence | WBPaper00039982 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000662 | Paper_evidence | WBPaper00039982 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lgc-55 mutant animals are indistinguishable from the wild-type with respect to exploratory behavior. | Paper_evidence | WBPaper00039982 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001101 | Paper_evidence | WBPaper00038382 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No effects on clozapine-induced egg laying were observed. | Paper_evidence | WBPaper00038382 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003634 | Paper_evidence | WBPaper00038382 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002026 | Paper_evidence | WBPaper00039982 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lgc-55 mutant animals are indistinguishable from the wild-type with respect to touch sensitivity. | Paper_evidence | WBPaper00039982 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038382 | ||||||||
WBPaper00039982 | |||||||||
WBPaper00033406 | |||||||||
WBPaper00048522 | |||||||||
Remark | 2603/2604-2900/2901 (297 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |