WormBase Tree Display for Variation: WBVar00251732

WBVar00251732 Name: Public_name: tm2920
    Other_name: F54D5.5a.2:c.727_1024del
      F54D5.5b.1:c.922_1219del
      CE36386:p.Arg243GlnfsTer9
      F54D5.5a.1:c.727_1024del
      CE37920:p.Arg308GlnfsTer9
    HGVSg: CHROMOSOME_II:g.11565380_11565729del
  Sequence_details: SMap: S_parent: Sequence: F54D5
    Flanking_sequences: gagtcattcccgtaagaccttgagaagttg atagcaatcccgctccttcttcactttatc
    Mapping_target: F54D5
    Source_location: 7 CHROMOSOME_II 11565379 11565730 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2920_external
      tm2920_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2920
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00010051
    Transcript: F54D5.5a.2 (11)
      F54D5.5a.1 (11)
      F54D5.5b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0001225 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. H. Sawa: non-Psa. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 25313/25314-25663/25664 (350 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele