WormBase Tree Display for Variation: WBVar00251747

WBVar00251747 Name: Public_name: tm2942
    Other_name: CE39114:p.Thr67AsnfsTer19
      W09C3.1.1:c.200_399del
    HGVSg: CHROMOSOME_I:g.4718124_4718493del
  Sequence_details: SMap: S_parent: Sequence: W09C3
    Flanking_sequences: ATAAGAACAATTTTCAGATTGAAAAAATGA ATTCGAACTCTTCTTGCTATCAAAACAATG
    Mapping_target: W09C3
    Type_of_mutation: Deletion
    PCR_product: tm2942_external
      tm2942_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2942
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00021109
    Transcript: W09C3.1.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
  Remark: 22298/22299-22668/22669 (370 bp deletion)
    This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele