WormBase Tree Display for Variation: WBVar00251760

WBVar00251760 Name: Public_name: tm2959
    Other_name: F53G2.7.1:c.502-311_579delinsGTA
    HGVSg: CHROMOSOME_II:g.2475434_2475822delinsTAC
  Sequence_details: SMap: S_parent: Sequence: F53G2
    Flanking_sequences: ctttttacgttcccgatccagaattacttc gtttttgtagatttttatggaaaattcaaa
    Mapping_target: F53G2
    Source_location: 7 CHROMOSOME_II 2475433 2475823 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TAC
      Deletion
    PCR_product: tm2959_external
      tm2959_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2959
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018769
    Transcript: F53G2.7.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F53G2.7.1:c.502-311_579delinsGTA
        cDNA_position: ?-664
        CDS_position: ?-579
        Protein_position: ?-193
        Intron_number: 7/10
        Exon_number: 8/11
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: FX
  Remark: 25040/25041-TAC-25429/25430 (389 bp deletion + 3 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele