WormBase Tree Display for Variation: WBVar00251765

WBVar00251765 Name: Public_name: tm2969
    Other_name: H34C03.1.1:c.555+76_565del
    HGVSg: CHROMOSOME_IV:g.6763907_6764110del
  Sequence_details: SMap: S_parent: Sequence: H34C03
    Flanking_sequences: cttgacacatttaaattttttagttaccat cgatattcaaacttcatgcaagtgaatatt
    Mapping_target: H34C03
    Source_location: 7 CHROMOSOME_IV 6763906 6764111 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2969_external
      tm2969_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2969
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004954
    Transcript: H34C03.1.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: H34C03.1.1:c.555+76_565del
        cDNA_position: ?-647
        CDS_position: ?-565
        Protein_position: ?-189
        Intron_number: 4/8
        Exon_number: 5/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 11274/11275-11478/11479 (204 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele