WormBase Tree Display for Variation: WBVar00251772

WBVar00251772 Name: Public_name: tm2978
    Other_name: B0395.2.1:c.684-33_857del
    HGVSg: CHROMOSOME_X:g.16032957_16033163del
  Sequence_details: SMap: S_parent: Sequence: B0395
    Flanking_sequences: caggcgtttcagcacccacgtgccatagca tgggatcatttgcatgacgtcacttttcta
    Mapping_target: B0395
    Source_location: 7 CHROMOSOME_X 16032956 16033164 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2978_external
      tm2978_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2978
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007174
    Transcript: B0395.2.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: B0395.2.1:c.684-33_857del
        cDNA_position: ?-873
        CDS_position: ?-857
        Protein_position: ?-286
        Intron_number: 6/9
        Exon_number: 7/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 13837/13838-14044/14045 (207 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele