WormBase Tree Display for Variation: WBVar00251777

WBVar00251777 Name: Public_name: tm2983
    HGVSg: CHROMOSOME_IV:g.10387760_10388347del
  Sequence_details: SMap: S_parent: Sequence: R10H10
    Flanking_sequences: tcagataaaatagtatttatttgtaaattt actttgaaagtcgtattagtagaattggtt
    Mapping_target: R10H10
    Source_location: 7 CHROMOSOME_IV 10387759 10388348 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2983_external
      tm2983_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2983
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003064
    Transcript: R10H10.1.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 4/5
        Exon_number: 5-6/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 6304/6305-6892/6893 (588 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele