WormBase Tree Display for Variation: WBVar00251787

WBVar00251787 Name: Public_name: tm2996
    Other_name: Y51H1A.5.1:c.653-10_917del
    HGVSg: CHROMOSOME_II:g.13886360_13886634del
  Sequence_details: SMap: S_parent: Sequence: Y51H1A
    Flanking_sequences: agggggcctcaaacagaccaatttttaagc actggccgcggattcggaatgggtgttgcg
    Mapping_target: Y51H1A
    Source_location: 7 CHROMOSOME_II 13886359 13886635 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2996_external
      tm2996_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2996
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001838
    Transcript: Y51H1A.5.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y51H1A.5.1:c.653-10_917del
        cDNA_position: ?-925
        CDS_position: ?-917
        Protein_position: ?-306
        Intron_number: 4/6
        Exon_number: 5/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Sawa: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001225 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Sawa: no Psa phenotype. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 29432/29433-29707/29708 (275 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele