WormBase Tree Display for Variation: WBVar00251812

WBVar00251812 Name: Public_name: tm3026
    Other_name: CE30792:p.Arg178SerfsTer7
      CE30791:p.Arg178SerfsTer7
      CE37235:p.Arg180SerfsTer7
      F42G9.6c.1:c.540_601del
      F42G9.6b.1:c.534_595del
      F42G9.6a.1:c.534_595del
    HGVSg: CHROMOSOME_III:g.782463_782581del
  Sequence_details: SMap: S_parent: Sequence: F42G9
    Flanking_sequences: ctaaatccgaatcaacgaagaatgaggata ctcatccgccggctccaggatttctgagca
    Mapping_target: F42G9
    Source_location: 7 CHROMOSOME_III 782462 782582 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3026_external
      tm3026_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3026
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018364
    Transcript: F42G9.6c.1 (11)
      F42G9.6a.1 (11)
      F42G9.6b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0001171 Paper_evidence: WBPaper00045327
        Curator_confirmed: WBPerson19323
      WBPhenotype:0001620 Paper_evidence: WBPaper00045327
        Curator_confirmed: WBPerson19323
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Reference: WBPaper00045327
  Remark: 26647/26648-26766/26767 (119 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele