WormBase Tree Display for Variation: WBVar00251819
expand all nodes | collapse all nodes | view schema
WBVar00251819 | Name | Public_name | tm3036 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name (21) | |||||||||
HGVSg | CHROMOSOME_III:g.3870942_3871210del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F13B10 | |||||
Flanking_sequences | gttcttgagcaatgagctgtcgaattttcc | catttgtgagcatttggtaggtgtaaacag | |||||||
Mapping_target | F13B10 | ||||||||
Source_location | 7 | CHROMOSOME_III | 3870941 | 3871211 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm3036_external | ||||||||
tm3036_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00021983 | ||||||||
WBStrain00021984 | |||||||||
WBStrain00055930 | |||||||||
Laboratory | FX | ||||||||
IG | |||||||||
JN | |||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 3036 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00171984 | |||||||
WBGene00006575 | |||||||||
Transcript (14) | |||||||||
Interactor | WBInteraction000503569 | ||||||||
WBInteraction000504797 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | III | |||||||
Description | Phenotype | WBPhenotype:0000039 | Paper_evidence | WBPaper00032031 | |||||
WBPaper00031666 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals had substantially reduced lifespans in the absence of infection. | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life span is decreased compared to wild type animals. | Paper_evidence | WBPaper00031666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Assayed on E. coli. | Paper_evidence | WBPaper00031666 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000142 | Paper_evidence | WBPaper00032031 | |||||||
WBPaper00031666 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Constitutive expression of pnlp-29::GFP as well as induction, by infection or high salt, was reduced. GFP expression was knocked down by half in untreated worms as well as worms treated with high osmotic stress or infection by D. coniospora. | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
D. coniospora pathogen induced upregulation of pnlp-29::GFP was blocked. | Paper_evidence | WBPaper00031666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Infections with a freshly harvested solution of D. coniospora spores were done as described [65]; worms were analyzed after 24 h at 25C. Worms were pricked in the tail region using a microinjection needle under a dissecting microscope and analyzed 6 h later for GFP induction or 2 hours later for qRT-PCR. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Animals were infected with D. coniospora at the L4 stage and maintained on OP50 at 20C. | Paper_evidence | WBPaper00031666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | frIs7 | Paper_evidence | WBPaper00031666 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00039901 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00039901 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | [str-2p::GFP] | Paper_evidence | WBPaper00039901 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00039901 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The localization pattern and level of UNC-43::GFP in the AWC axons is similar in wild type and tir-1(tm3036lf) mutants. | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00039901 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | [str-2p::GFP] | Paper_evidence | WBPaper00039901 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00032031 | |||||||
WBPaper00031666 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals had marked reductions in resistance to D. coniospora infection. | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals exhibit a significant reduction in survival when infected with D. coniospora. | Paper_evidence | WBPaper00031666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Infections with a freshly harvested solution of D. coniospora spores were done as described [65]; worms were analyzed after 24 h at 25C. Worms were pricked in the tail region using a microinjection needle under a dissecting microscope and analyzed 6 h later for GFP induction or 2 hours later for qRT-PCR. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Animals were infected with D. coniospora at the L4 stage and maintained on OP50 at 20C. | Paper_evidence | WBPaper00031666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001351 | Paper_evidence | WBPaper00037959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PMK-1 activation in response to anoxia was suppressed in the tir-1(tm3036) mutant. | Paper_evidence | WBPaper00037959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005312 | Paper_evidence | WBPaper00037959 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001381 | Paper_evidence | WBPaper00037959 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | A mutation in the TIR domain-containing adaptor protein TIR-1 increased the survival rate in anoxia. | Paper_evidence | WBPaper00037959 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00039901 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Loss-of-function mutants showed a 2AWC-ON phenotype resembling that caused by nocodazole treatment. | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00039901 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00039901 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | [str-2p::GFP] | Paper_evidence | WBPaper00039901 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001687 | Paper_evidence | WBPaper00056945 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | tir-1(tm3036) animals showed positive staining of L2-L4 stages. mAb M37 stains only the L1 stage in wild type C. elegans under normal growth conditions. | Paper_evidence | WBPaper00056945 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014905 | Paper_evidence | WBPaper00056945 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001838 | Paper_evidence | WBPaper00033094 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The PMA-induced upregulation of pnlp-29::GFP expression was blocked in tir-1(tm3036) mutant | Paper_evidence | WBPaper00033094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | frIs7 [pnlp-29::GFP] | Paper_evidence | WBPaper00033094 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. J. Ewbank: Curr. Biol. 18, 481 (2008). | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Laboratory_evidence | FX | ||||||||
IG | |||||||||
WBPhenotype:0001725 | Paper_evidence | WBPaper00032031 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Osmotic stress triggered upregulation of nlp-29 was not affected, based on the fluorescent ratio of control to experiment animals. | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Osmotic stress was done in liquid by incubating young adult worms in 300 mM NaCl for 6 h, with analysis occuring 24 hours later. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | frIs7 | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001839 | Paper_evidence | WBPaper00033094 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants were not resistant to PMA | Paper_evidence | WBPaper00033094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | frIs7 [pnlp-29::GFP] | Paper_evidence | WBPaper00033094 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00037959 | ||||||||
WBPaper00039901 | |||||||||
WBPaper00033094 | |||||||||
WBPaper00032031 | |||||||||
WBPaper00031666 | |||||||||
WBPaper00056945 | |||||||||
WBPaper00065298 | |||||||||
WBPaper00065833 | |||||||||
WBPaper00066032 | |||||||||
Remark | 2308/2309-2577/2578 (269 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |