WormBase Tree Display for Variation: WBVar00251825

WBVar00251825 Name: Public_name: tm3042
    Other_name: CE46363:p.Lys117PhefsTer15
      W03H9.4a.1:c.348_442del
    HGVSg: CHROMOSOME_II:g.14141546_14141727del
  Sequence_details: SMap: S_parent: Sequence: W03H9
    Flanking_sequences: ccatgtcttccttggcggcggctcgcgaat ccctctctttccaactttttgccccagaca
    Mapping_target: W03H9
    Source_location: 7 CHROMOSOME_II 14141545 14141728 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3042_external
      tm3042_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3042
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00012230
    Transcript: W03H9.4a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000055 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project from Dr. E. Cram: L1-L2 arrest. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: UN
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. E. Cram: L1-L2 arrest. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
              UN
      WBPhenotype:0000638 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project from Dr. E. Cram: Mlt. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: UN
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 53/54-235/236 (182 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele