WormBase Tree Display for Variation: WBVar00251825
expand all nodes | collapse all nodes | view schema
WBVar00251825 | Name | Public_name | tm3042 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE46363:p.Lys117PhefsTer15 | |||||||
W03H9.4a.1:c.348_442del | ||||||||
HGVSg | CHROMOSOME_II:g.14141546_14141727del | |||||||
Sequence_details | SMap | S_parent | Sequence | W03H9 | ||||
Flanking_sequences | ccatgtcttccttggcggcggctcgcgaat | ccctctctttccaactttttgccccagaca | ||||||
Mapping_target | W03H9 | |||||||
Source_location | 7 | CHROMOSOME_II | 14141545 | 14141728 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm3042_external | |||||||
tm3042_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3042 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00012230 | ||||||
Transcript | W03H9.4a.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype | WBPhenotype:0000055 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project from Dr. E. Cram: L1-L2 arrest. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | UN | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. E. Cram: L1-L2 arrest. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
UN | ||||||||
WBPhenotype:0000638 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project from Dr. E. Cram: Mlt. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | UN | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 53/54-235/236 (182 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |