WormBase Tree Display for Variation: WBVar00251838
expand all nodes | collapse all nodes | view schema
WBVar00251838 | Name | Public_name | tm3055 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C18A11.5b.1:c.66_354+5del | |||||||
C18A11.5c.1:c.66_354+5del | ||||||||
HGVSg | CHROMOSOME_X:g.8041392_8041776del | |||||||
Sequence_details | SMap | S_parent | Sequence | C18A11 | ||||
Flanking_sequences | aatattggggattgataggagcgaaaacag | ttatcaggattttttagatactgaacgatc | ||||||
Mapping_target | C18A11 | |||||||
Source_location | 7 | CHROMOSOME_X | 8041391 | 8041777 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm3055_external | |||||||
tm3055_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3055 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006962 | ||||||
WBGene00305277 | ||||||||
Transcript | C18A11.5c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C18A11.5c.1:c.66_354+5del | |||||||
cDNA_position | 66-? | |||||||
CDS_position | 66-? | |||||||
Protein_position | 22-? | |||||||
Intron_number | 1-3/6 | |||||||
Exon_number | 1-3/7 | |||||||
C18A11.14 | ||||||||
C18A11.5b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C18A11.5b.1:c.66_354+5del | |||||||
cDNA_position | 80-? | |||||||
CDS_position | 66-? | |||||||
Protein_position | 22-? | |||||||
Intron_number | 2-4/8 | |||||||
Exon_number | 2-4/9 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000065 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. H. Zhang: male Let. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. H. Zhang: normal locomotion | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson557 | |||||||
Remark | 8184/8185-8569/8570 (385 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |