WormBase Tree Display for Variation: WBVar00251844

WBVar00251844 Name: Public_name: tm3061
    Other_name: F57C2.6a.1:c.138_377del
      CE35560:p.Phe47_Ter126delextTer?
      CE46980:p.Phe47_Ter126delextTer?
      F57C2.6b.1:c.138_377del
    HGVSg: CHROMOSOME_II:g.14528974_14529358del
  Sequence_details: SMap: S_parent: Sequence: F57C2
    Flanking_sequences: gccaatcgccgcagagcgtcccagcaagat agaatcgtgtagtcagcagaaagacagcga
    Mapping_target: F57C2
    Source_location: 7 CHROMOSOME_II 14528973 14529359 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3061_external
      tm3061_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3061
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00010198
    Transcript: F57C2.6b.1 (11)
      F57C2.6a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. M. Gotta: Ste. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
              ZU
  Remark: 10574/10575-10959/10960 (385 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele