WormBase Tree Display for Variation: WBVar00251880
expand all nodes | collapse all nodes | view schema
WBVar00251880 | Name | Public_name | tm3102 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | W02F12.6.1:c.50_303del | |||||||
CE31084:p.Ile17AsnfsTer14 | ||||||||
HGVSg | CHROMOSOME_V:g.6710050_6710350del | |||||||
Sequence_details | SMap | S_parent | Sequence | W02F12 | ||||
Flanking_sequences | aaattcctgttgtaatgttggccaaaatgt | tttgcttttcgatttcggcgatagctgcgt | ||||||
Mapping_target | W02F12 | |||||||
Source_location | 7 | CHROMOSOME_V | 6710049 | 6710351 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm3102_external | |||||||
tm3102_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3102 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00020951 | ||||||
Transcript | W02F12.6.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype | WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. T. Blumenthal to the National Bioresource Project of Japan:viable at 20 C and sterile at 15 C. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 15C | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment from Dr. T. Blumenthal to the NBP: viable at 20 C and sterile at 15 C. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20C | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 16932/16933-17233/17234 (301 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |