WormBase Tree Display for Variation: WBVar00251889

WBVar00251889 Name: Public_name: tm3112
    Other_name: C18F3.4b.1:c.79-62_240del
      C18F3.4a.1:c.79-62_240del
    HGVSg: CHROMOSOME_IV:g.8085918_8086141del
  Sequence_details: SMap: S_parent: Sequence: C18F3
    Flanking_sequences: aagtgatgagtgaggattcgattgtcttcg agagttcatactaaacaactttagtaggta
    Mapping_target: C18F3
    Source_location: 7 CHROMOSOME_IV 8085917 8086142 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3112_external
      tm3112_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3112
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00044508
    Transcript: C18F3.4a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C18F3.4a.1:c.79-62_240del
        cDNA_position: ?-241
        CDS_position: ?-240
        Protein_position: ?-80
        Intron_number: 2/6
        Exon_number: 3/7
      C18F3.4b.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C18F3.4b.1:c.79-62_240del
        cDNA_position: ?-241
        CDS_position: ?-240
        Protein_position: ?-80
        Intron_number: 2/6
        Exon_number: 3/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 31538/31539-31762/31763 (224 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele