WormBase Tree Display for Variation: WBVar00251894

WBVar00251894 Name: Public_name: tm3118
    Other_name: D2021.1a.1:c.1669-130_2085del
      D2021.1b.1:c.1654-130_2070del
    HGVSg: CHROMOSOME_X:g.8560684_8561230del
  Sequence_details: SMap: S_parent: Sequence: D2021
    Flanking_sequences: cttttctatgttctattgtcgcatgtaaaa gaagctcaaagtctggaattacaacggttt
    Mapping_target: D2021
    Source_location: 7 CHROMOSOME_X 8560683 8561231 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3118_external
      tm3118_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3118
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00017046
    Transcript: D2021.1a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: D2021.1a.1:c.1669-130_2085del
        cDNA_position: ?-2114
        CDS_position: ?-2085
        Protein_position: ?-695
        Intron_number: 11/15
        Exon_number: 12/16
      D2021.1b.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: D2021.1b.1:c.1654-130_2070del
        cDNA_position: ?-2104
        CDS_position: ?-2070
        Protein_position: ?-690
        Intron_number: 11/15
        Exon_number: 12/16
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000007 Paper_evidence: WBPaper00040076
        Curator_confirmed: WBPerson712
        Remark: Heterozygous and balanced worms [stDp2(X;II)/+ II; utx-1(tm3118)] exhibit a higher incidence of matricide (also called bagging) than wild type (N2) worms. Paper_evidence: WBPaper00040076
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: [stDp2(X;II)/+ II; utx-1(tm3118) X] Paper_evidence: WBPaper00040076
              Curator_confirmed: WBPerson712
      WBPhenotype:0000052 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. R.H. Horvitz: Mel, homozygous mothers lay lethal progeny (embryonic or L1) Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000061 Paper_evidence: WBPaper00040076
        Curator_confirmed: WBPerson712
        Remark: The lifespan of utx-1 heterozygous worms [stDp2(X;II)/+ II; utx-1(tm3118)]worms was compared to that of the balancer strain. utx-1(3118) heterozygous worms have a significant increase in their mean lifespan compared to the control worms. Paper_evidence: WBPaper00040076
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: [stDp2(X;II)/+ II; utx-1(tm3118) X] Paper_evidence: WBPaper00040076
              Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Originally classified as 'homozygous viable' by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Originally classified as 'not sterile' by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Reference: WBPaper00040076
  Remark: 17360/17361-17907/17908 (547 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele