WormBase Tree Display for Variation: WBVar00251895

WBVar00251895 Name: Public_name: tm3119
    Other_name: K07H8.9.1:c.220_555-4del
    HGVSg: CHROMOSOME_IV:g.8285540_8286005del
  Sequence_details: SMap: S_parent: Sequence: K07H8
    Flanking_sequences: ATGACGCGAAGTGGCAAATCAATTGCACTG GCCGATCTCTTAAAATCATAAAAACATTAG
    Mapping_target: K07H8
    Type_of_mutation: Deletion
    PCR_product: tm3119_external
      tm3119_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3119
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00019509
    Transcript: K07H8.9.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: K07H8.9.1:c.220_555-4del
        cDNA_position: 380-?
        CDS_position: 220-?
        Protein_position: 74-?
        Intron_number: 4/5
        Exon_number: 4/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 26166/26167-26632/26633 (466 bp deletion)
    This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele