WormBase Tree Display for Variation: WBVar00251954

WBVar00251954 Name: Public_name: tm3191
  Sequence_details: SMap: S_parent: Sequence: F25H8
    Flanking_sequences: ttaatttaattttcactgttttttatcttt cttttaaaatcccgagtcatcatccccgat
    Mapping_target: F25H8
    Source_location: 7 CHROMOSOME_IV 9910745 9911184 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TCANCACATGTNCTTNTTTT
      Deletion
    PCR_product: tm3191_external
      tm3191_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3191
    NBP_allele
    Status: Live
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
  Remark: 4789/4790-TCANCACATGTNCTTNTTTT-5227/5228 (438 bp deletion + 20 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele