WormBase Tree Display for Variation: WBVar00251968

WBVar00251968 Name: Public_name: tm3212
    Other_name: F27D9.1a.1:c.345_563+9del
    HGVSg: CHROMOSOME_X:g.7683441_7683714del
  Sequence_details: SMap: S_parent: Sequence: F27D9
    Flanking_sequences: cgaagcgtgttcggatcagctcttctcaac gaaagaaaaaacataaaatatttcatatga
    Mapping_target: F27D9
    Source_location: 7 CHROMOSOME_X 7683440 7683715 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3212_external
      tm3212_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3212
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006757
    Transcript: F27D9.1a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F27D9.1a.1:c.345_563+9del
        cDNA_position: 381-?
        CDS_position: 345-?
        Protein_position: 115-?
        Intron_number: 5-6/10
        Exon_number: 5-6/11
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as uncoordinated by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 33513/33514-33787/33788 (274 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele