WormBase Tree Display for Variation: WBVar00251984

WBVar00251984 Name: Public_name: tm3238
    Other_name: CE15235:p.Leu78_Ter165delextTer?
      ZC581.1.1:c.232_495del
    HGVSg: CHROMOSOME_I:g.6663613_6663968del
  Sequence_details: SMap: S_parent: Sequence: ZC581
    Flanking_sequences: tatattgattcttttattatggataatcaa aaatctgcagcgtcgactgttattggaact
    Mapping_target: ZC581
    Source_location: 7 CHROMOSOME_I 6663612 6663969 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3238_external
      tm3238_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3238
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022631
    Transcript: ZC581.1.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 32041/32042-32397/32398 (356 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele