WormBase Tree Display for Variation: WBVar00252003

WBVar00252003 Name: Public_name: tm3268
    Other_name: F58G6.4a.1:c.501_593delinsTCGA
      CE49811:p.Asp172ArgfsTer6
      F58G6.4a.2:c.501_593delinsTCGA
      F58G6.4b.1:c.513_605delinsTCGA
      CE28039:p.Asp168ArgfsTer6
    HGVSg: CHROMOSOME_IV:g.9661817_9662057delinsTCGA
  Sequence_details: SMap: S_parent: Sequence: F58G6
    Flanking_sequences: ttgtgatatgaaactaaaaagatttccgtt gctcaaaagaattgaacttcctgatttcaa
    Mapping_target: F58G6
    Source_location: 7 CHROMOSOME_IV 9661816 9662058 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TCGA
      Deletion
    PCR_product: tm3268_external
      tm3268_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3268
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00010275
    Transcript: F58G6.4b.1 (11)
      F58G6.4a.1 (11)
      F58G6.4a.2 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0004028 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. C. Bargmann: reduced locomotion on food. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: CX
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001225 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Sawa: not Psa. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: HS
  Reference: WBPaper00065804
  Remark: 22068/22069-TCGA-22309/22310 (241 bp deletion + 4 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele