WormBase Tree Display for Variation: WBVar00252016

WBVar00252016 Name: Public_name: tm3288
    Other_name: T05B11.3.1:c.218_519-29del
    HGVSg: CHROMOSOME_V:g.7734127_7734546del
  Sequence_details: SMap: S_parent: Sequence: T05B11
    Flanking_sequences: tcctgcaatttttaaaatgaaaattgggaa gtccatccaaatcgactccggaatcagttg
    Mapping_target: T05B11
    Source_location: 7 CHROMOSOME_V 7734126 7734547 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3288_external
      tm3288_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3288
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00020246
    Transcript: T05B11.3.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T05B11.3.1:c.218_519-29del
        cDNA_position: 244-?
        CDS_position: 218-?
        Protein_position: 73-?
        Intron_number: 4/5
        Exon_number: 4/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000436 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. O. Blacque: wild-type localization of ODR-10 to AWB cilium. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OEB
      WBPhenotype:0002535 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. O. Blacque: Dyf (+). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OEB
  Remark: 2205/2206-2625/2626 (420 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele