WormBase Tree Display for Variation: WBVar00252059
expand all nodes | collapse all nodes | view schema
WBVar00252059 | Name | Public_name | tm3364 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | M03F8.2e.1:c.-654+357_-10+87delinsTGAAATTTT | ||||||||
M03F8.2b.1:c.202+357_846+87delinsTGAAATTTT | |||||||||
M03F8.2a.1:c.157+357_801+87delinsTGAAATTTT | |||||||||
M03F8.2d.1:c.157+357_801+87delinsTGAAATTTT | |||||||||
M03F8.2c.1:c.202+357_846+87delinsTGAAATTTT | |||||||||
HGVSg | CHROMOSOME_V:g.5945383_5946568delinsTGAAATTTT | ||||||||
Sequence_details | SMap | S_parent | Sequence | M03F8 | |||||
Flanking_sequences | tttatggctaaatgtatcaattttcccttt | ttgaaattttttgtgaaaaacaatttttgc | |||||||
Mapping_target | M03F8 | ||||||||
Source_location | 7 | CHROMOSOME_V | 5945382 | 5946569 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | TGAAATTTT | |||||||
Deletion | |||||||||
PCR_product | tm3364_external | ||||||||
tm3364_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 3364 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004206 | |||||||
Transcript | M03F8.2e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | M03F8.2e.1:c.-654+357_-10+87delinsTGAAATTTT | ||||||||
Intron_number | 1-3/7 | ||||||||
Exon_number | 2-3/8 | ||||||||
M03F8.2d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | M03F8.2d.1:c.157+357_801+87delinsTGAAATTTT | ||||||||
Intron_number | 3-5/8 | ||||||||
Exon_number | 4-5/9 | ||||||||
M03F8.2c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | M03F8.2c.1:c.202+357_846+87delinsTGAAATTTT | ||||||||
Intron_number | 2-4/7 | ||||||||
Exon_number | 3-4/8 | ||||||||
M03F8.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | M03F8.2a.1:c.157+357_801+87delinsTGAAATTTT | ||||||||
Intron_number | 3-5/7 | ||||||||
Exon_number | 4-5/8 | ||||||||
M03F8.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | M03F8.2b.1:c.202+357_846+87delinsTGAAATTTT | ||||||||
Intron_number | 3-5/7 | ||||||||
Exon_number | 4-5/8 | ||||||||
Interactor | WBInteraction000500894 | ||||||||
WBInteraction000500895 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | V | |||||||
Description | Phenotype (19) | ||||||||
Phenotype_not_observed | WBPhenotype:0000047 | Paper_evidence | WBPaper00036358 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No abnormalities were observed for Ea and Ep cell ingression. | Paper_evidence | WBPaper00036358 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000748 | Paper_evidence | WBPaper00036358 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No abnormalities in this phenotype were observed in these mutants. | Paper_evidence | WBPaper00036358 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004015 | PATO:0000460 | Paper_evidence | WBPaper00036358 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006770 | PATO:0000460 | Paper_evidence | WBPaper00036358 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001018 | Paper_evidence | WBPaper00036358 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No abnormalities in this phenotype were observed in these mutants. | Paper_evidence | WBPaper00036358 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00036358 | ||||||||
Remark | 14054/14055-TGAAATTTT-15240/15241 (1186 bp deletion + 9 bp insertion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |