WormBase Tree Display for Variation: WBVar00252083

WBVar00252083 Name: Public_name: tm3392
    Other_name: CE32610:p.Asp180_Ter428delinsGlu
      C43E11.4.1:c.540_1283del
    HGVSg: CHROMOSOME_I:g.4248346_4249223del
  Sequence_details: SMap: S_parent: Sequence: C43E11
    Flanking_sequences: agcggatttggttgaagaagatgatctgga gaaacataatcttaaaaagtccgctgaaaa
    Mapping_target: C43E11
    Source_location: 7 CHROMOSOME_I 4248345 4249224 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3392_external
      tm3392_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3392
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007001
    Transcript: C43E11.4.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 19342/19343-20220/20221 (878 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele