WormBase Tree Display for Variation: WBVar00252086

WBVar00252086 Name: Public_name: tm3395
    Other_name: C18E3.2.1:c.195+7_575delinsTT
    HGVSg: CHROMOSOME_I:g.4211266_4211686delinsTT
  Sequence_details: SMap: S_parent: Sequence: C18E3
    Flanking_sequences: gcggataaatgtattcatccaaaggtttta tcgcacaccacaaaccaacgaaactgatgg
    Mapping_target: C18E3
    Source_location: 7 CHROMOSOME_I 4211265 4211687 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TT
      Deletion
    PCR_product: tm3395_external
      tm3395_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00031318
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3395
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015971
    Transcript: C18E3.2.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C18E3.2.1:c.195+7_575delinsTT
        cDNA_position: ?-593
        CDS_position: ?-575
        Protein_position: ?-192
        Intron_number: 3/5
        Exon_number: 4/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001612 Paper_evidence: WBPaper00046494
        Curator_confirmed: WBPerson712
        Remark: swsn-2.2(tm3395) mutants initially are resistant to the depressive effects of ethanol on locomotion and do not develop AFT. Paper_evidence: WBPaper00046494
            Curator_confirmed: WBPerson712
      WBPhenotype:0002278 Paper_evidence: WBPaper00046494
        Curator_confirmed: WBPerson712
        Remark: swsn-2.2(tm3395) mutants initially are resistant to the depressive effects of ethanol on locomotion and do not develop AFT. Paper_evidence: WBPaper00046494
            Curator_confirmed: WBPerson712
  Disease_info: Models_disease: DOID:1574
    Models_disease_in_annotation: WBDOannot00000665
  Reference: WBPaper00046494
  Remark: 26234/26235-TT-26655/26656 (421 bp deletion + 2 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele