WormBase Tree Display for Variation: WBVar00252102

WBVar00252102 Name: Public_name: tm3416
    Other_name: Y116A8C.32a.1:c.665-21_738-193del
    HGVSg: CHROMOSOME_IV:g.17108227_17108573del
  Sequence_details: SMap: S_parent: Sequence: Y116A8C
    Flanking_sequences: tcggtctaaaagccttaaagattaggatta gcccggaaattagtcagaaaatcgatgaaa
    Mapping_target: Y116A8C
    Source_location: 7 CHROMOSOME_IV 17108225 17108574 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: A
      Deletion
    PCR_product: tm3416_external
      tm3416_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3416
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00013808
    Transcript: Y116A8C.32a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y116A8C.32a.1:c.665-21_738-193del
        Intron_number: 3-4/8
        Exon_number: 4/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 208135/208136-A-208483/208484 (348 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele