WormBase Tree Display for Variation: WBVar00252120

WBVar00252120 Name: Public_name: tm3439
    Other_name: F29C12.4.1:c.1592+9_1965del
    HGVSg: CHROMOSOME_II:g.13121160_13121582del
  Sequence_details: SMap: S_parent: Sequence: F29C12
    Flanking_sequences: agtgcttgggtagcccttataagtgagtga gaattccagggaaatgtagtgacatcactc
    Mapping_target: F29C12
    Source_location: 7 CHROMOSOME_II 13121159 13121583 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3439_external
      tm3439_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3439
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009246
    Transcript: F29C12.4.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F29C12.4.1:c.1592+9_1965del
        cDNA_position: ?-1975
        CDS_position: ?-1965
        Protein_position: ?-655
        Intron_number: 6/7
        Exon_number: 7/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 21109/21110-21532/21533 (423 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele