WormBase Tree Display for Variation: WBVar00252144
expand all nodes | collapse all nodes | view schema
WBVar00252144 | Name | Public_name | tm3470 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y54G2A.31.1:c.281-363_281-84delinsAATGTT | |||||||
HGVSg | CHROMOSOME_IV:g.2924455_2924734delinsAACATT | |||||||
Sequence_details | SMap | S_parent | Sequence | Y54G2A | ||||
Flanking_sequences | agcagtttttcgagataattcgcattaaaa | aaaatgtccctcgaaaactgggggttcgcc | ||||||
Mapping_target | Y54G2A | |||||||
Source_location | 7 | CHROMOSOME_IV | 2924454 | 2924735 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | AACATT | ||||||
Deletion | ||||||||
PCR_product | tm3470_external | |||||||
tm3470_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3470 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006708 | ||||||
Transcript | Y54G2A.31.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | Y54G2A.31.1:c.281-363_281-84delinsAATGTT | |||||||
Intron_number | 2/4 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000030 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. Y. Jin: grow well. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000679 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. C. Rongo: Normal GLR-1::GFP localization. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001206 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. Y. Jin: no movement defects | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 174233/174234-AACATT-174513/174514 (280 bp deletion + 6 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |