WormBase Tree Display for Variation: WBVar00252144

WBVar00252144 Name: Public_name: tm3470
    Other_name: Y54G2A.31.1:c.281-363_281-84delinsAATGTT
    HGVSg: CHROMOSOME_IV:g.2924455_2924734delinsAACATT
  Sequence_details: SMap: S_parent: Sequence: Y54G2A
    Flanking_sequences: agcagtttttcgagataattcgcattaaaa aaaatgtccctcgaaaactgggggttcgcc
    Mapping_target: Y54G2A
    Source_location: 7 CHROMOSOME_IV 2924454 2924735 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AACATT
      Deletion
    PCR_product: tm3470_external
      tm3470_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3470
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006708
    Transcript: Y54G2A.31.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: Y54G2A.31.1:c.281-363_281-84delinsAATGTT
        Intron_number: 2/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype_not_observed: WBPhenotype:0000030 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. Y. Jin: grow well. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000679 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. C. Rongo: Normal GLR-1::GFP localization. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001206 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. Y. Jin: no movement defects Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 174233/174234-AACATT-174513/174514 (280 bp deletion + 6 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele