WormBase Tree Display for Variation: WBVar00252177

WBVar00252177 Name: Public_name: tm3508
    Other_name: K07A12.3.1:c.200_324del
      CE11868:p.Lys67SerfsTer11
    HGVSg: CHROMOSOME_I:g.8693147_8693318del
  Sequence_details: SMap: S_parent: Sequence: K07A12
    Flanking_sequences: gggctaagctccagaagtttattgagacca gccaattatgtctcgaaggatacaaaggct
    Mapping_target: K07A12
    Source_location: 7 CHROMOSOME_I 8693146 8693319 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3508_external
      tm3508_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3508
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000209
    Transcript: K07A12.3.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Dr. H-S. Koo: Ste. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 27614/27615-27786/27787 (172 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele