WormBase Tree Display for Variation: WBVar00252194

WBVar00252194 Name: Public_name: tm3527
    Other_name: CE24801:p.Trp24LeufsTer2
      C14A4.14.1:c.68_84del
    HGVSg: CHROMOSOME_II:g.10582697_10582766del
  Sequence_details: SMap: S_parent: Sequence: C14A4
    Flanking_sequences: ggctttcagccgaggttcgatctgcatcgc aactctaaaacaccagacgacatcaatgtt
    Mapping_target: C14A4
    Source_location: 7 CHROMOSOME_II 10582696 10582767 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3527_external
      tm3527_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3527
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007564
    Transcript: C14A4.14.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 2840/2841-2910/2911 (70 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele