WormBase Tree Display for Variation: WBVar00252208

WBVar00252208 Name: Public_name: tm3546
    Other_name: Y54G2A.31.1:c.264_280+217del
    HGVSg: CHROMOSOME_IV:g.2925194_2925427del
  Sequence_details: SMap: S_parent: Sequence: Y54G2A
    Flanking_sequences: aaaaaattcatctaaactcgtgaatattgt caaattctgccgagtttatcaatattcgga
    Mapping_target: Y54G2A
    Source_location: 7 CHROMOSOME_IV 2925193 2925428 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3546_external
      tm3546_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3546
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006708
    Transcript: Y54G2A.31.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y54G2A.31.1:c.264_280+217del
        cDNA_position: 265-?
        CDS_position: 264-?
        Protein_position: 88-?
        Intron_number: 2/4
        Exon_number: 2/5
    Interactor: WBInteraction000517535
      WBInteraction000517554
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype_not_observed: WBPhenotype:0000030 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. Y. Jin: grow well Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Reclassified as homozygous viable by the National Bioresource Project of Japan; originally classified as lethal OR sterile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001206 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. Y. Jin: no movement defects Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001676 Paper_evidence: WBPaper00036408
        Curator_confirmed: WBPerson712
        Remark: Animals exhibit normal touch neurons. Paper_evidence: WBPaper00036408
            Curator_confirmed: WBPerson712
  Reference: WBPaper00036408
  Remark: 174972/174973-175206/175207 (234 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele