WormBase Tree Display for Variation: WBVar00252217

WBVar00252217 Name: Public_name: tm3560
    Other_name (13)
    HGVSg: CHROMOSOME_V:g.4501482_4501912delinsC
  Sequence_details: SMap: S_parent: Sequence: T28F12
    Flanking_sequences: ttgtgcctgtttttttttcaaaattaaaca acagacccaagagaatgctgacaagcagta
    Mapping_target: T28F12
    Source_location: 7 CHROMOSOME_V 4501481 4501913 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: C
      Deletion
    PCR_product: tm3560_external
      tm3560_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3560
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006796
    Transcript (13)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark (2)
  Method: NBP_knockout_allele