WormBase Tree Display for Variation: WBVar00252234

WBVar00252234 Name: Public_name: tm3583
    Other_name: CE18675:p.Lys479_Asp662delinsAsn
      F43G6.9.1:c.1437_1985del
    HGVSg: CHROMOSOME_II:g.11775598_11776197del
  Sequence_details: SMap: S_parent: Sequence: F44E5
    Flanking_sequences: ttggacatttgcatgagtttagacaagtca ttatcacgccatgtctttaaaatgttaatt
    Mapping_target: F44E5
    Source_location: 7 CHROMOSOME_II 11775597 11776198 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3583_external
      tm3583_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3583
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009661
    Transcript: F43G6.9.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: [F44E5] 27176/27177-[F44E5] 27776/27777 (600 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele