WormBase Tree Display for Variation: WBVar00252237

WBVar00252237 Name: Public_name: tm3586
    Other_name: F45E4.9.1:c.106_441delinsAAA
      CE10508:p.Pro36_Ter147delinsLys
    HGVSg: CHROMOSOME_IV:g.7645725_7646113delinsTTT
  Sequence_details: SMap: S_parent: Sequence: F45E4
    Flanking_sequences: tttctccttggattccattccagctccaga attgatattcattccaagagggacttgtgg
    Mapping_target: F45E4
    Source_location: 7 CHROMOSOME_IV 7645724 7646114 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TTT
      Deletion
    PCR_product: tm3586_external
      tm3586_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3586
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001975
    Transcript: F45E4.9.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 39271/39272-TTT-39660/39661 (389 bp deletion + 3 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele