WormBase Tree Display for Variation: WBVar00252247

WBVar00252247 Name: Public_name: tm3608
    HGVSg: CHROMOSOME_II:g.5990606_5990785delinsCCAATTTCCGAATCAATCATC
  Sequence_details: SMap: S_parent: Sequence: ZK75
    Flanking_sequences: gttatggaatccaatttccgaatcatcata aggcgtgacgcgcaattcagataaatacag
    Mapping_target: ZK75
    Source_location: 7 CHROMOSOME_II 5990605 5990786 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CCAATTTCCGAATCAATCATC
      Deletion
    PCR_product: tm3608_external
      tm3608_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3608
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002086
    Transcript: ZK75.3.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-163
        CDS_position: ?-105
        Protein_position: ?-35
        Exon_number: 1-2/4
    Interactor: WBInteraction000543214
      WBInteraction000543251
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000022 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. Q.L. Ch'ng, Dr. J. Kaplan: non-Lon. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000229 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. Q.L. Ch'ng, Dr. J. Kaplan: non-Sma. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
      WBPhenotype:0000583 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. Q.L. Ch'ng, Dr. J. Kaplan: non-Dpy. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. Q.L. Ch'ng, Dr. J. Kaplan: non-Unc. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
      WBPhenotype:0000697 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. Q.L. Ch'ng, Dr. J. Kaplan: non-Pvl. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
  Remark: 11710/11711-CCAATTTCCGAATCAATCATC-11890/11891 (180 bp deletion + 21 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele