WormBase Tree Display for Variation: WBVar00252253

WBVar00252253 Name: Public_name: tm3615
    Other_name: F25G6.2.1:c.3418-566_3418-400delinsACG
    HGVSg: CHROMOSOME_V:g.8580641_8580807delinsACG
  Sequence_details: SMap: S_parent: Sequence: C10B5
    Flanking_sequences: tgcgcagcgttgtagggatccgctggtgag ggccagctgctgccaagtagggtgagctgt
    Mapping_target: C10B5
    Source_location: 7 CHROMOSOME_V 8580640 8580808 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: ACG
      Deletion
    PCR_product: tm3615_external
      tm3615_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3615
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00023454
      WBGene00017797
    Transcript: F25G6.10
      F25G6.2.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: F25G6.2.1:c.3418-566_3418-400delinsACG
        Intron_number: 5/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 40767/40768-ACG-40934/40935 (167 bp deletion + 3 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target F25G6 updated based on the VEP analysis pipeline to C10B5.
  Method: NBP_knockout_allele