WormBase Tree Display for Variation: WBVar00252256

WBVar00252256 Name: Public_name: tm3618
    HGVSg: CHROMOSOME_X:g.8866086_8866296delinsCACACAGCTTAGAGAGATCCTGTTCCGT
  Sequence_details: SMap: S_parent: Sequence: C06E2
    Flanking_sequences: tcagaaagcatatcaataaaatatcagtat agcacagcttagagagatcctgttccgtac
    Mapping_target: C06E2
    Source_location: 7 CHROMOSOME_X 8866085 8866297 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CACACAGCTTAGAGAGATCCTGTTCCGT
      Deletion
    PCR_product: tm3618_external
      tm3618_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3618
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002092
    Transcript: C06E2.8.1 VEP_consequence: coding_sequence_variant,3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 322-?
        CDS_position: 299-?
        Protein_position: 100-?
        Exon_number: 3-4/4
    Interactor: WBInteraction000543197
      WBInteraction000543221
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype_not_observed: WBPhenotype:0000022 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. Q.L. Ch'ng: non-Lon. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000229 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. Q.L. Ch'ng: non-Sma. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
      WBPhenotype:0000583 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. Q.L. Ch'ng: non-Dpy. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. Q.L. Ch'ng: non-Unc. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
      WBPhenotype:0000697 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. Q.L. Ch'ng: non-Pvl. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
  Remark: 15546/15547-CACACAGCTTAGAGAGATCCTGTTCCGT-15757/15758 (211 bp deletion + 28 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele