WormBase Tree Display for Variation: WBVar00252264
expand all nodes | collapse all nodes | view schema
| WBVar00252264 | Name | Public_name | tm3627 | |||||
|---|---|---|---|---|---|---|---|---|
| Other_name | B0222.9.1:c.1347_1775del | |||||||
| CE48200:p.Leu449_Ter592delinsPhe | ||||||||
| HGVSg | CHROMOSOME_V:g.9170743_9171259del | |||||||
| Sequence_details | SMap | S_parent | Sequence | C24B5 | ||||
| Flanking_sequences | gtcgtgtcgtcaggaaagttcatgtttgaa | aatcgttttggttgcccaccaagaccaaca | ||||||
| Mapping_target | C24B5 | |||||||
| Source_location | 7 | CHROMOSOME_V | 9170742 | 9171260 | Inferred_automatically | National_Bioresource_Project | ||
| Type_of_mutation | Deletion | |||||||
| PCR_product | tm3627_external | |||||||
| tm3627_internal | ||||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Laboratory | FX | |||||||
| Author | Mitani S | |||||||
| DB_info | Database | National_Bioresource_Project | seq | 3627 | ||||
| NBP_allele | ||||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00015057 | ||||||
| Transcript | B0222.9.1 (11) | |||||||
| Isolation | Mutagen | TMP/UV | ||||||
| Genetics | Map | V | ||||||
| Description | Phenotype | WBPhenotype:0000047 | Paper_evidence | WBPaper00038341 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Endodermal precursors internalized later than at the wild-type 2E stage. | Paper_evidence | WBPaper00038341 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00038341 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Classified as lethal or sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | FX | |||||||
| WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Classified as lethal or sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | FX | |||||||
| Reference | WBPaper00038341 | |||||||
| Remark | 38199/38200-38716/38717 (517 bp deletion) | |||||||
| This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
| Method | NBP_knockout_allele |
