WormBase Tree Display for Variation: WBVar00252305

WBVar00252305 Name: Public_name: tm3688
    Other_name: C41C4.6.1:c.433-100_544del
    HGVSg: CHROMOSOME_II:g.8132190_8132401del
  Sequence_details: SMap: S_parent: Sequence: C41C4
    Flanking_sequences: atgattcattatttaaagttcaagtttata atctttctttacggcagcacgcctttgatt
    Mapping_target: C41C4
    Source_location: 7 CHROMOSOME_II 8132189 8132402 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3688_external
      tm3688_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3688
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006739
    Transcript: C41C4.6.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C41C4.6.1:c.433-100_544del
        cDNA_position: ?-593
        CDS_position: ?-544
        Protein_position: ?-182
        Intron_number: 4/6
        Exon_number: 5/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000019 Paper_evidence: WBPaper00045692
        Curator_confirmed: WBPerson2987
        Remark: "To unveil the function of ULP-4 SUMO protease, we characterized the phenotypes resulting from a deletion in the ulp-4 locus. This allele introduces a frame shift followed by a stop codon at the beginning of exon 4 (Fig S6), presumably resulting in a severe decrease of ULP-4 function. Worms homozygous for this allele are viable but exhibit phenotypes associated with impaired metabolism. ulp-4 mutants are almost completely sterile; furthermore, their pumping rate and locomotion undergo a notable decline with age (Fig 3A)." Paper_evidence: WBPaper00045692
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000061 Paper_evidence: WBPaper00045692
        Curator_confirmed: WBPerson2987
        Remark: "To unveil the function of ULP-4 SUMO protease, we characterized the phenotypes resulting from a deletion in the ulp-4 locus. This allele introduces a frame shift followed by a stop codon at the beginning of exon 4 (Fig S6), presumably resulting in a severe decrease of ULP-4 function. Worms homozygous for this allele are viable but exhibit phenotypes associated with impaired metabolism... Remarkably, these phenotypes show a strong age dependency consistent with ulp-4 age-dependent expression as well as with the proposed role of ULP-4 as a regulator of the mevalonate pathway. Consistent with this observation, ulp-4 mutant worms are long-lived, whereas ULP-4::GFP worms, in which ULP-4 is mildly overexpressed, are short-lived (Fig S7)." Paper_evidence: WBPaper00045692
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000577 Paper_evidence: WBPaper00045692
        Curator_confirmed: WBPerson2987
        Remark: "To unveil the function of ULP-4 SUMO protease, we characterized the phenotypes resulting from a deletion in the ulp-4 locus. This allele introduces a frame shift followed by a stop codon at the beginning of exon 4 (Fig S6), presumably resulting in a severe decrease of ULP-4 function. Worms homozygous for this allele are viable but exhibit phenotypes associated with impaired metabolism." Paper_evidence: WBPaper00045692
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000688 Paper_evidence: WBPaper00045692
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
          WBPerson2987
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
          "To unveil the function of ULP-4 SUMO protease, we characterized the phenotypes resulting from a deletion in the ulp-4 locus. This allele introduces a frame shift followed by a stop codon at the beginning of exon 4 (Fig S6), presumably resulting in a severe decrease of ULP-4 function. Worms homozygous for this allele are viable but exhibit phenotypes associated with impaired metabolism. ulp-4 mutants are almost completely sterile; furthermore, their pumping rate and locomotion undergo a notable decline with age (Fig 3A)." Paper_evidence: WBPaper00045692
            Curator_confirmed: WBPerson2987
      WBPhenotype:0001183 Paper_evidence: WBPaper00045692
        Curator_confirmed: WBPerson2987
        Remark: "To unveil the function of ULP-4 SUMO protease, we characterized the phenotypes resulting from a deletion in the ulp-4 locus. This allele introduces a frame shift followed by a stop codon at the beginning of exon 4 (Fig S6), presumably resulting in a severe decrease of ULP-4 function. Worms homozygous for this allele are viable but exhibit phenotypes associated with impaired metabolism... In addition, ulp-4 mutants have significantly less fat (Fig S6C). This effect can be partially rescued by the ULP-4::GFP construct, demonstrating that these phenotypes stem from ULP-4 loss." Paper_evidence: WBPaper00045692
            Curator_confirmed: WBPerson2987
        Rescued_by_transgene: WBTransgene00020192
      WBPhenotype:0001213 Paper_evidence: WBPaper00045692
        Curator_confirmed: WBPerson2987
        Remark: "To unveil the function of ULP-4 SUMO protease, we characterized the phenotypes resulting from a deletion in the ulp-4 locus. This allele introduces a frame shift followed by a stop codon at the beginning of exon 4 (Fig S6), presumably resulting in a severe decrease of ULP-4 function. Worms homozygous for this allele are viable but exhibit phenotypes associated with impaired metabolism. ulp-4 mutants are almost completely sterile; furthermore, their pumping rate and locomotion undergo a notable decline with age (Fig 3A)." Paper_evidence: WBPaper00045692
            Curator_confirmed: WBPerson2987
      WBPhenotype:0001893 Paper_evidence: WBPaper00045692
        Curator_confirmed: WBPerson2987
        Remark: "ulp-4 mutant mitochondria fail to maintain normal membrane potential as determined by tetramethylrhodamine ethyl ester (TMRE) staining (Fig 3D)." Paper_evidence: WBPaper00045692
            Curator_confirmed: WBPerson2987
      WBPhenotype:0002163 Paper_evidence: WBPaper00045692
        Curator_confirmed: WBPerson2987
        Remark: "In addition, ulp-4 loss results in decreased oxygen consumption relative to WT worms (Fig 3E), whereas ULP-4::GFP worms consume more oxygen than WT worms." Paper_evidence: WBPaper00045692
            Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0000062 Paper_evidence: WBPaper00045692
        Curator_confirmed: WBPerson2987
        Remark: "To unveil the function of ULP-4 SUMO protease, we characterized the phenotypes resulting from a deletion in the ulp-4 locus. This allele introduces a frame shift followed by a stop codon at the beginning of exon 4 (Fig S6), presumably resulting in a severe decrease of ULP-4 function. Worms homozygous for this allele are viable but exhibit phenotypes associated with impaired metabolism." Paper_evidence: WBPaper00045692
            Curator_confirmed: WBPerson2987
  Reference: WBPaper00045692
  Remark: 32717/32718-32929/32930 (212 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele