WormBase Tree Display for Variation: WBVar00252306

WBVar00252306 Name: Public_name: tm3689
    HGVSg: CHROMOSOME_V:g.14043754_14044394del
  Sequence_details: SMap: S_parent: Sequence: T08G5
    Flanking_sequences: tgaatcttatgtatgatctcatttcctcac ccaaaatgtccaacttacgaatctaagaag
    Mapping_target: T08G5
    Source_location: 7 CHROMOSOME_V 14043753 14044395 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3689_external
      tm3689_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3689
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00011626
      WBGene00219553
    Transcript: T08G5.7.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-21
        CDS_position: ?-21
        Protein_position: ?-7
        Exon_number: 1/3
      T08G5.19
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 27085/27086-27726/27727 (641 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele